pRS316 GAL cluster
(Plasmid
#61925)
-
PurposeExpression of GAL1 and GAL10 from S. cerevisiae cloned into pRS316
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS316
- Total vector size (bp) 10066
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameGAL1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1587
-
Entrez GeneGAL1 (a.k.a. YBR020W)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GAL1 (AATATACCTCTATACTTTAACGTC)
- 3′ sequencing primer T7
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGAL10
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2100
-
GenBank IDNM_001178367.1
-
Entrez GeneGAL10 (a.k.a. YBR019C)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Gal10pro-F (GGTGGTAATGCCATGTAATATG)
- 3′ sequencing primer M13-R
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS316 GAL cluster was a gift from Jon Houseley (Addgene plasmid # 61925 ; http://n2t.net/addgene:61925 ; RRID:Addgene_61925) -
For your References section:
Endogenous RNA interference is driven by copy number. Cruz C, Houseley J. Elife. 2014 Feb 11;3:e01581. doi: 10.7554/eLife.01581. 10.7554/eLife.01581 PubMed 24520161