pAB-LIC C
(Plasmid
#62288)
-
Purpose(Empty Backbone) Baculovirus expression vector for secretion with N-terminal Honeybee melittin signal and C-terminal 8xHis tag
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62288 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAB-bee
- Backbone size (bp) 10000
-
Modifications to backboneAdds one or two (A) amino acids after the signalase cleavage site before the 8xHis tag
-
Vector typeInsect Expression ; Baculovirus
- Promoter polyhedrin
-
Tags
/ Fusion Proteins
- 8XHis tag (N terminal on backbone)
- 8XHis tag (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer phF 5’ AGACGCACAAACTAATATCACAAACTGGA 3’
- 3′ sequencing primer mR 5’ CGTGTCGGGTTTAACATTACGGAT 3’ (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAB-LIC C was a gift from Cheryl Arrowsmith (Addgene plasmid # 62288 ; http://n2t.net/addgene:62288 ; RRID:Addgene_62288)