pJZC593
(Plasmid
#62319)
-
PurposesgRNA with MS2-PP7 for yeast cells
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62319 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS416
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA + MS2-PP7 RNA binding module
-
gRNA/shRNA sequenceACTTTTCTCTATCACTGATA
- Promoter SNR52
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtaaaacgacggccagt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJZC593 was a gift from Wendell Lim & Stanley Qi (Addgene plasmid # 62319 ; http://n2t.net/addgene:62319 ; RRID:Addgene_62319) -
For your References section:
Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Zalatan JG, Lee ME, Almeida R, Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. 10.1016/j.cell.2014.11.052 PubMed 25533786