pJZC595
(Plasmid
#62322)
-
PurposeExpresses MCP-VP64 and dCas9 in Yeast cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62322 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNH605
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMCP-VP64
- Promoter pAdh
-
Tag
/ Fusion Protein
- VP64 (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCTGCACAATATTTCAAGC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedCas9
-
MutationHas nuclease-inactivating mutations in the RuvC1 and HNH domains
- Promoter Tdh3
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGTAGGTATTGATTGTAATTCTG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJZC595 was a gift from Wendell Lim & Stanley Qi (Addgene plasmid # 62322 ; http://n2t.net/addgene:62322 ; RRID:Addgene_62322) -
For your References section:
Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Zalatan JG, Lee ME, Almeida R, Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. 10.1016/j.cell.2014.11.052 PubMed 25533786