Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62341)


Item Catalog # Description Quantity Price (USD)
Plasmid 62341 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    MP177_U6 (derived from pSico)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Marked by mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Mutation
    Targets sv40 promoter, sequence: GAATAGCTCAGAGGCCGAGG
  • Promoter U6

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    COM RNA binding protein fused to a KRAB domain
  • Promoter CMV
  • Tag / Fusion Protein
    • KRAB (C terminal on insert)

Cloning Information for Gene/Insert 2

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJZC73 was a gift from Wendell Lim & Stanley Qi (Addgene plasmid # 62341)
  • For your References section:

    Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Zalatan JG, Lee ME, Almeida R, Gilbert LA, Whitehead EH, La Russa M, Tsai JC, Weissman JS, Dueber JE, Qi LS, Lim WA. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. 10.1016/j.cell.2014.11.052 PubMed 25533786