- 
            PurposeMammalian CRISPR-SP-Cas9 reporter
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62733 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonePHAGE2
 - Backbone size w/o insert (bp) 8172
 - Total vector size (bp) 8960
 - 
              Vector typeMammalian Expression, Lentiviral, CRISPR
 - 
                Selectable markersPuromycin
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)Stbl3
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameCRISPR-SP-Cas9 target seq + tdTomato (out of frame)
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)781
 - Promoter EF1-Alpha
 - 
    
        Tags
        / Fusion Proteins
    
- HA tag (N terminal on insert)
 - CRISPR-SP-Cas9 target seq (hAAVS1 locus) (N terminal on insert)
 
 
Cloning Information
- Cloning method Ligation Independent Cloning
 - 5′ sequencing primer GGTGGAGACTGAAGTTAGGCCAG
 - 3′ sequencing primer CAAGAAGACAGGGCCAGGTTTCCG (Common Sequencing Primers)
 
Resource Information
- 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
CRISPR-SP-Cas9 reporter was a gift from Niels Geijsen (Addgene plasmid # 62733 ; http://n2t.net/addgene:62733 ; RRID:Addgene_62733) - 
                
For your References section:
Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214