Skip to main content

CRISPR-SP-Cas9 reporter
(Plasmid #62733)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62733 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PHAGE2
  • Backbone size w/o insert (bp) 8172
  • Total vector size (bp) 8960
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPR-SP-Cas9 target seq + tdTomato (out of frame)
  • Species
    Synthetic
  • Insert Size (bp)
    781
  • Promoter EF1-Alpha
  • Tags / Fusion Proteins
    • HA tag (N terminal on insert)
    • CRISPR-SP-Cas9 target seq (hAAVS1 locus) (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGTGGAGACTGAAGTTAGGCCAG
  • 3′ sequencing primer CAAGAAGACAGGGCCAGGTTTCCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRISPR-SP-Cas9 reporter was a gift from Niels Geijsen (Addgene plasmid # 62733 ; http://n2t.net/addgene:62733 ; RRID:Addgene_62733)
  • For your References section:

    Efficient Intracellular Delivery of Native Proteins. D'Astolfo DS, Pagliero RJ, Pras A, Karthaus WR, Clevers H, Prasad V, Lebbink RJ, Rehmann H, Geijsen N. Cell. 2015 Apr 23;161(3):674-690. doi: 10.1016/j.cell.2015.03.028. 10.1016/j.cell.2015.03.028 PubMed 25910214