pJEP217-Lenti-CMV-GFP-WPRE-pA
(Plasmid
#62925)
-
PurposepLenti vector backbone designed to express GFP from a CMV promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti7.3DEST
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6824
- Total vector size (bp) 7610
-
Modifications to backboneModified the backbone by removing the emGFP expression cassette and adding multiple cloning site (MCS) via ClaI and MluI sites.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGreen Fluorescent protein (GFP)
-
Insert Size (bp)786
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer tagtagacataatagcaacag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP217-Lenti-CMV-GFP-WPRE-pA was a gift from Jonathan Ploski (Addgene plasmid # 62925 ; http://n2t.net/addgene:62925 ; RRID:Addgene_62925) -
For your References section:
The production of viral vectors designed to express large and difficult to express transgenes within neurons. Holehonnur R, Lella SK, Ho A, Luong JA, Ploski JE. Mol Brain. 2015 Feb 24;8:12. doi: 10.1186/s13041-015-0100-7. 10.1186/s13041-015-0100-7 PubMed 25887710