Endolyn-delta pMEP4
(Plasmid
#62962)
-
Purposefull length rat Endolyn cloned into delta pMEP4
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonedelta pMEP4
-
Backbone manufacturerGirotti and Banting, PMID 9013339
-
Modifications to backbonepMEP4 (Invitrogen), lacking a non-essential 4.5 kb region (nucleotides 5,570-10,114)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEndolyn
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)626
-
GenBank IDAJ238574.1
-
Entrez GeneCd164 (a.k.a. MGC-24v)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhei (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer 5’ AACCCGCGTGCAACCTGT 3’
- 3′ sequencing primer 5’ CTTGTTTATTGCAGCTTATAATGG 3’
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Endolyn-delta pMEP4 was a gift from Paul Luzio (Addgene plasmid # 62962 ; http://n2t.net/addgene:62962 ; RRID:Addgene_62962) -
For your References section:
Endolyn is a mucin-like type I membrane protein targeted to lysosomes by its cytoplasmic tail. Ihrke G, Gray SR, Luzio JP. Biochem J. 2000 Jan 15;345 Pt 2:287-96. PubMed 10620506