-
Purposefull length human CD63 cloned into pEGFP C2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP C2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD63 molecule
-
SpeciesH. sapiens (human)
-
Insert Size (bp)749
-
MutationCD63 has 1 silent mutation compared to the coding sequence of NM_001267698.1 N129 AAT instead of AAC
-
GenBank IDNM_001267698.1
-
Entrez GeneCD63 (a.k.a. AD1, HOP-26, ME491, MLA1, OMA81H, Pltgp40, TSPAN30)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5’ CCGACAACCACTACCTGAGC 3’
- 3′ sequencing primer 5’ ACAAACCACAACTAGAATGCAG 3’ (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Examples of use:
Blagoveshchenskaya AD, Hannah MJ, Allen S, Cutler DF. (2002) Selective and signal-dependent recruitment of membrane proteins to secretory granules formed by heterologously expressed von Willebrand factor. Mol Biol Cell 13:1582-1593.
Bampton ET, Goemans CG, Niranjan D, Mizushima N, Tolkovsky AM. (2005) The dynamics of autophagy visualized in live cells: from autophagosome formation to fusion with endo/lysosomes.
Autophagy 1: 23-36.
Harrison-Lavoie KJ, Michaux G, Hewlett L, Kaur J, Hannah MJ, Lui-Roberts WW, Norman KE, Cutler DF. (2006) P-selectin and CD63 use different mechanisms for delivery to Weibel-Palade bodies.
Traffic 7: 647-662.
Babich V, Meli A, Knipe L, Dempster JE, Skehel P, Hannah MJ, Carter T. (2008) Selective release of molecules from Weibel-Palade bodies during a lingering kiss. Blood 111: 5282-5290.
Babich V, Knipe L, Hewlett L, Meli A, Dempster J, Hannah MJ, Carter T. (2009) Differential effect of extracellular acidosis on the release and dispersal of soluble and membrane proteins secreted from the Weibel-Palade body.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CD63-pEGFP C2 was a gift from Paul Luzio (Addgene plasmid # 62964 ; http://n2t.net/addgene:62964 ; RRID:Addgene_62964)