Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #63141)


Item Catalog # Description Quantity Price (USD)
Plasmid 63141 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    original from Stratagene
  • Backbone size w/o insert (bp) 4707
  • Total vector size (bp) 6183
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    archaerhodopsin TP009-GFP
  • Species
    Halorubrum sp. TP009
  • Insert Size (bp)
  • GenBank ID
  • Promoter human synapsin promoter
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer TAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is sequenced completely by the depositing lab except for parts of both ITRs. Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

For additional information on Arch, please see Chow et al., Nature. 2010 Jan 7. 463(7277):98-102. PubMed ID: 20054397

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Syn-ArchT-GFP was a gift from Edward Boyden (Addgene plasmid # 63141 ; ; RRID:Addgene_63141)
  • For your References section:

    A high-light sensitivity optical neural silencer: development and application to optogenetic control of non-human primate cortex. Han X, Chow BY, Zhou H, Klapoetke NC, Chuong A, Rajimehr R, Yang A, Baratta MV, Winkle J, Desimone R, Boyden ES. Front Syst Neurosci. 2011;5:18. Epub 2011 Apr 13. 10.3389/fnsys.2011.00018 PubMed 21811444