pHoss1
(Plasmid #63158)

• Purpose: Suicide plasmid for efficient gene mutation in Gram-positive bacteria
• Depositing Lab: Attila Karsi
• Publication: Abdelhamed et al Plasmid. 2015 May 31;81:1-8. doi: 10.1016/j.plasmid.2015.05.003.

Backbone

• Vector backbone: pMAD
• Backbone manufacturer: Arnaud et al. 2004. Applied and Environmental Microbiology, 70:6887-6891
• Backbone size w/o insert (bp): 9666
• Total vector size (bp): 8995
• Modifications to backbone: Thermostable -galactosidase (bgaB) was removed from pMAD using BglII and BseRI restriction enzymes.
• Vector type: Suicide plasmid for Gram-positive bacteria
• Selectable markers: Erythromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: anti-secY-Pxyl/tetO-tetR

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (not destroyed)
• 3′ cloning site: BglII (destroyed during cloning)
• 5′ sequencing primer: GATCTAATGATTCAAACCCTTGTG
• 3′ sequencing primer: TGAAGTTACCATCACGGAAAAAGG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Gene origin is described in our publication describing pHoss1 (gene was PCR amplified from pIMAY vector) https://www.ncbi.nlm.nih.gov/pubmed/26038185

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: Addgene's quality control sequencing finds an H63R amino acid residue substitution in the TetR ORF. This residue change does not affect TetR activity, and the plasmid functions as described.