pJFRC208-10XUAS-FRT>STOP>FRT-myr::smGFP-FLAG
(Plasmid
#63169)
-
PurposeGAL4-responsive UAS “flp-On” spaghetti monster GFP-FLAG reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJFRC12-10XUAS-IVS-myr::GFP
- Total vector size (bp) 9899
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name"spaghetti monster GFP-FLAG"
-
Alt namesmGFP-FLAG
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1300
-
Tag
/ Fusion Protein
- N-myristoylation (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GACTACACCTTTGGCCAGACG
- 3′ sequencing primer GTGACGAATCTTGAAATTAGCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC208-10XUAS-FRT>STOP>FRT-myr::smGFP-FLAG was a gift from Gerald Rubin (Addgene plasmid # 63169 ; http://n2t.net/addgene:63169 ; RRID:Addgene_63169) -
For your References section:
Optimized tools for multicolor stochastic labeling reveal diverse stereotyped cell arrangements in the fly visual system. Nern A, Pfeiffer BD, Rubin GM. Proc Natl Acad Sci U S A. 2015 May 11. pii: 201506763. 10.1073/pnas.1506763112 PubMed 25964354