Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMarsL274G
(Plasmid #63177)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 63177 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1+
  • Total vector size (bp) 8086
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MarsL274G
  • Alt name
    Mars
  • Alt name
    methionine-tRNA synthetase (L274G)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2753
  • Mutation
    L274G
  • GenBank ID
    NP_001003913
  • Entrez Gene
    Mars (a.k.a. Metrs, Mtrns)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site xho1 (not destroyed)
  • 5′ sequencing primer GCTCTCTGGCTAACTAGAGAACCCACTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Developed by Alborz Mahdavi.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMarsL274G was a gift from David Tirrell (Addgene plasmid # 63177 ; http://n2t.net/addgene:63177 ; RRID:Addgene_63177)
  • For your References section:

    Engineered Aminoacyl-tRNA Synthetase for Cell-Selective Analysis of Mammalian Protein Synthesis. Mahdavi A, Hamblin GD, Jindal GA, Bagert JD, Dong C, Sweredoski MJ, Hess S, Schuman EM, Tirrell DA. J Am Chem Soc. 2016 Apr 6;138(13):4278-81. doi: 10.1021/jacs.5b08980. Epub 2016 Mar 25. 10.1021/jacs.5b08980 PubMed 26991063