- 
            PurposeEncodes E. coli biotin ligase gene (BirA) for expression in yeast cells
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63682 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepVTU-260
- 
              Backbone manufacturerEuroscarf
- Backbone size w/o insert (bp) 6929
- 
              Vector typeYeast Expression
- 
                Selectable markersURA3
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)Top10
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nameBirA
- 
                  Alt nameE coli biotin ligase
- 
                    SpeciesE. coli
- 
                  Insert Size (bp)966
- Promoter ADH1/yeast
- 
    
        Tags
        / Fusion Proteins
    - 6X Histidine (N terminal on backbone)
- TEV cleavage site (N terminal on backbone)
 
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5' TTTTCTGCACAATATTTCAAGC� 3'
- 3′ sequencing primer 5' AGTCCAAAGCTGGATCCTTATTT� 3' (Common Sequencing Primers)
Resource Information
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pVTU_260_BirA was a gift from Aaron Hoskins (Addgene plasmid # 63682 ; http://n2t.net/addgene:63682 ; RRID:Addgene_63682)
- 
                For your References section: Rapid isolation and single-molecule analysis of ribonucleoproteins from cell lysate by SNAP-SiMPull. Rodgers ML, Paulson J, Hoskins AA. RNA. 2015 May;21(5):1031-41. doi: 10.1261/rna.047845.114. Epub 2015 Mar 24. 10.1261/rna.047845.114 PubMed 25805862
