Skip to main content

pX330_sgACTA2
(Plasmid #63712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63712 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Total vector size (bp) 8518
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ACTA2
  • gRNA/shRNA sequence
    gcggtggacaatggaaggcc
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Entrez Gene
    ACTA2 (a.k.a. ACTSA)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_sgACTA2 was a gift from Stanley Qi (Addgene plasmid # 63712 ; http://n2t.net/addgene:63712 ; RRID:Addgene_63712)
  • For your References section:

    Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Yu C, Liu Y, Ma T, Liu K, Xu S, Zhang Y, Liu H, La Russa M, Xie M, Ding S, Qi LS. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003. 10.1016/j.stem.2015.01.003 PubMed 25658371