pGS1312
(Plasmid
#63786)
-
PurposeVector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal eCFP Strep-tag II followed by URA3 selection marker
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGS1212
- Backbone size w/o insert (bp) 4940
- Total vector size (bp) 4940
-
Vector typeE. coli cloning vector
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeCFP-Strep-tag II followed by URA3
-
SpeciesSynthetic
- Promoter none
-
Tag
/ Fusion Protein
- eCFP-Strep-tag II (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BsrGI/Bsp1407I (not destroyed)
- 5′ sequencing primer CTGGCTTAACTATGCGGCATCAG
- 3′ sequencing primer gcaacctgacctacaggaaagag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMark A. Sheff and Kurt S. Thorn
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence of the eCFP gene has been optimized for S. cerevisiae and generated by gene synthesis. The Strep-tag II sequence is adapted from the sequence of commercial Strep-tag II plasmids offered by IBA, Goettingen, Germany.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGS1312 was a gift from Monika Golas & Bjoern Sander (Addgene plasmid # 63786 ; http://n2t.net/addgene:63786 ; RRID:Addgene_63786) -
For your References section:
Strep-tag II and Twin-Strep Based Cassettes for Protein Tagging by Homologous Recombination and Characterization of Endogenous Macromolecular Assemblies in Saccharomyces cerevisiae. Rai J, Pemmasani JK, Voronovsky A, Jensen IS, Manavalan A, Nyengaard JR, Golas MM, Sander B. Mol Biotechnol. 2014 Jun 27. 10.1007/s12033-014-9778-5 PubMed 24969434