Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-FLAG-Akt2-CA
(Plasmid #64050)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64050 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti-hiko
  • Backbone size w/o insert (bp) 9124
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AKT2
  • Alt name
    PKB beta
  • Alt name
    v-akt murine thymoma viral oncogene homolog 2
  • Alt name
    RAC-BETA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1446
  • GenBank ID
    NM_001626.5
  • Entrez Gene
    AKT2 (a.k.a. HIHGHH, PKBB, PKBBETA, PRKBB, RAC-BETA)
  • Promoter Ubiquitin
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • MYR (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    human AKT2 sequence was derived from Addgene #9016

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The MYR sequence was inserted in frame at EcoRI/NheI site into N terminal of pLenti-FLAG-hAkt2

Please cite the following article:
Lim, C.-Y. et al. Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Nat Commun 6, 5951 (2015).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-FLAG-Akt2-CA was a gift from Weiping Han (Addgene plasmid # 64050 ; http://n2t.net/addgene:64050 ; RRID:Addgene_64050)
  • For your References section:

    Tropomodulin3 is a novel Akt2 effector regulating insulin-stimulated GLUT4 exocytosis through cortical actin remodeling. Lim CY, Bi X, Wu D, Kim JB, Gunning PW, Hong W, Han W. Nat Commun. 2015 Jan 9;6:5951. doi: 10.1038/ncomms6951. 10.1038/ncomms6951 PubMed 25575350