Skip to main content

L304-EGFP-Tubulin-WT
(Plasmid #64060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    L304
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tubulin
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene sequencing results identified a duplication of the EGFP-Tubulin insert. It is not known how this impacts plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    L304-EGFP-Tubulin-WT was a gift from Weiping Han (Addgene plasmid # 64060 ; http://n2t.net/addgene:64060 ; RRID:Addgene_64060)
  • For your References section:

    Regulation of adipogenesis by cytoskeleton remodelling is facilitated by acetyltransferase MEC-17-dependent acetylation of alpha-tubulin. Yang W, Guo X, Thein S, Xu F, Sugii S, Baas PW, Radda GK, Han W. Biochem J. 2013 Feb 1;449(3):605-12. doi: 10.1042/BJ20121121. 10.1042/BJ20121121 PubMed 23126280