L309-myc-seipin-ΔCT
(Plasmid
#64062)
-
Purposemyc-tagged murine seipin with deletion of cytosolic C-terminus); lentiviral construct
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneL309
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebscl2
-
SpeciesM. musculus (mouse)
-
MutationDeletion of C-terminal Asp338–Ser443
-
Entrez GeneBscl2 (a.k.a. 2900097C17Rik, Gng3lg)
-
Tag
/ Fusion Protein
- myc epitope (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer GGCGAGTGTGTTTTGTGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L309-myc-seipin-ΔCT was a gift from Weiping Han (Addgene plasmid # 64062 ; http://n2t.net/addgene:64062 ; RRID:Addgene_64062) -
For your References section:
Seipin differentially regulates lipogenesis and adipogenesis through a conserved core sequence and an evolutionarily acquired C-terminus. Yang W, Thein S, Guo X, Xu F, Venkatesh B, Sugii S, Radda GK, Han W. Biochem J. 2013 May 15;452(1):37-44. doi: 10.1042/BJ20121870. 10.1042/BJ20121870 PubMed 23458123