MLS-mir-17-92-Mut92
(Plasmid
#64094)
-
Purposeexpresses a mutated version of mir-17-92 (mutation of miR-92 seed)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64094 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-SV40-GFP
- Backbone size w/o insert (bp) 6216
- Total vector size (bp) 7166
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiR-17-92
-
SpeciesH. sapiens (human)
-
Insert Size (bp)950
-
Mutationmutation of miR-92 seed sequence
-
Entrez GeneMIR17HG (a.k.a. C13orf25, FGLDS2, LINC00048, MIHG1, MIRH1, MIRHG1, NCRNA00048, miR-17-92)
- Promoter MSCV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GCCCTCACTCCTTCTCTAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MLS-mir-17-92-Mut92 was a gift from Lin He (Addgene plasmid # 64094 ; http://n2t.net/addgene:64094 ; RRID:Addgene_64094) -
For your References section:
A component of the mir-17-92 polycistronic oncomir promotes oncogene-dependent apoptosis. Olive V, Sabio E, Bennett MJ, De Jong CS, Biton A, McGann JC, Greaney SK, Sodir NM, Zhou AY, Balakrishnan A, Foth M, Luftig MA, Goga A, Speed TP, Xuan Z, Evan GI, Wan Y, Minella AC, He L. Elife. 2013 Oct 15;2:e00822. doi: 10.7554/eLife.00822. 10.7554/eLife.00822 PubMed 24137534