Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

MLS-mir-17-92-Mut20
(Plasmid #64095)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64095 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV-SV40-GFP
  • Backbone size w/o insert (bp) 6216
  • Total vector size (bp) 7166
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-17-92
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    950
  • Mutation
    mutation of miR-20 seed sequence
  • Entrez Gene
    MIR17HG (a.k.a. C13orf25, FGLDS2, LINC00048, MIHG1, MIRH1, MIRHG1, NCRNA00048, miR-17-92)
  • Promoter MSCV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer GCCCTCACTCCTTCTCTAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MLS-mir-17-92-Mut20 was a gift from Lin He (Addgene plasmid # 64095 ; http://n2t.net/addgene:64095 ; RRID:Addgene_64095)
  • For your References section:

    A component of the mir-17-92 polycistronic oncomir promotes oncogene-dependent apoptosis. Olive V, Sabio E, Bennett MJ, De Jong CS, Biton A, McGann JC, Greaney SK, Sodir NM, Zhou AY, Balakrishnan A, Foth M, Luftig MA, Goga A, Speed TP, Xuan Z, Evan GI, Wan Y, Minella AC, He L. Elife. 2013 Oct 15;2:e00822. doi: 10.7554/eLife.00822. 10.7554/eLife.00822 PubMed 24137534