-
PurposeKIF5C motor protein aa1-559 with C-terminal tandem dimer Tomato and FKBP tags
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBa.KIF5C 1-559.eGFP
-
Backbone manufacturerBanker lab (Addgene plasmid #45059)
- Backbone size w/o insert (bp) 8410
- Total vector size (bp) 9444
-
Modifications to backboneGFP removed and tdTomato-FKBP added
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKif5c
-
Alt nameKif5c560
-
Alt namekinesin family member 5C
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1676
-
Mutationmotor domain aa1-559
-
GenBank IDNM_001107730.1
-
Entrez GeneKif5c
- Promoter chicken Beta Actin
-
Tags
/ Fusion Proteins
- tdTomato (C terminal on insert)
- FKBP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site HpaI (not destroyed)
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKif 5c received from Bruce Schnapp, Oregon Health & Science University
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 64211 ; http://n2t.net/addgene:64211 ; RRID:Addgene_64211) -
For your References section:
A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations. Bentley M, Decker H, Luisi J, Banker G. J Cell Biol. 2015 Feb 2;208(3):273-281. Epub 2015 Jan 26. 10.1083/jcb.201408056 PubMed 25624392