-
PurposeExpresses infrared fluorescent tobacco etch virus protease sensor (iTEV)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5360
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameInfrared fluorescent tobacco etch virus protease sensor (iTEV)
-
Alt nameiTEV
-
SpeciesSynthetic
-
Insert Size (bp)1635
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 iTEV was a gift from Xiaokun Shu (Addgene plasmid # 64277 ; http://n2t.net/addgene:64277 ; RRID:Addgene_64277) -
For your References section:
Rationally designed fluorogenic protease reporter visualizes spatiotemporal dynamics of apoptosis in vivo. To TL, Piggott BJ, Makhijani K, Yu D, Jan YN, Shu X. Proc Natl Acad Sci U S A. 2015 Mar 17;112(11):3338-43. doi: 10.1073/pnas.1502857112. Epub 2015 Mar 2. 10.1073/pnas.1502857112 PubMed 25733847