Skip to main content

3xFLAG-dCas9/p-bacteria
(Plasmid #64325)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64325 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A vector
  • Backbone size w/o insert (bp) 2598
  • Total vector size (bp) 6777
  • Vector type
    Bacterial Expression, CRISPR ; Tetracycline-inducible

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG-dCas9
  • Species
    Synthetic; S. pyogenes
  • Insert Size (bp)
    4179
  • Mutation
    D10A, H840A
  • Promoter pLtetO-1
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer cgattccgacctcattaagcagc
  • 3′ sequencing primer tgcctggagatccttactcgaGTTAGTCACCTCCTAGCTGACTCAAATCAAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A portion of this plasmid was derived from a plasmid made by Stanley Qi (Addgene plasmid 44249)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is compatible with gRNA expression plasmids for E. coli, such as Addgene Plasmid #44251 ( http://www.addgene.org/44251 ).

Plasmid also described in Fujita, T. and Fujii, H., Biochem Biophys Res Commun. 2013 Sep 13;439(1):132-6. doi: 10.1016/j.bbrc.2013.08.013, PMID: 23942116

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xFLAG-dCas9/p-bacteria was a gift from Hodaka Fujii (Addgene plasmid # 64325 ; http://n2t.net/addgene:64325 ; RRID:Addgene_64325)
  • For your References section:

    An enChIP system for the analysis of bacterial genome functions. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Jun 14;11(1):387. doi: 10.1186/s13104-018-3486-3. 10.1186/s13104-018-3486-3 PubMed 29898790