gRNA-his-HYB
(Plasmid
#64333)
-
Purposehis3 deletion gRNA cassette carried by pRS42H
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS42H
- Backbone size w/o insert (bp) 6217
- Total vector size (bp) 6509
-
Vector typeYeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsTop10 also works
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegBlock product of his3 deletion gRNA cassette
-
gRNA/shRNA sequenceattgcgatctctttaaaggg
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's quality control sequencing finds one mismatch with the depositor's provided sequence, but plasmid function is not impacted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA-his-HYB was a gift from Yong-Su Jin (Addgene plasmid # 64333 ; http://n2t.net/addgene:64333 ; RRID:Addgene_64333) -
For your References section:
Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Zhang GC, Kong II, Kim H, Liu JJ, Cate JH, Jin YS. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. 10.1128/AEM.02310-14 PubMed 25281382