pRPR1_c2gRNA_RPR1t
              
              
                (Plasmid
                
                #64380)
              
            
            
            
          - 
            Purposeencodes c2 gRNA
 - 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRS425
 - Backbone size w/o insert (bp) 4000
 - Total vector size (bp) 4020
 - 
              Vector typeYeast Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namec2 gRNA
 - 
                    gRNA/shRNA sequenceATATTCTTTCCTTATACATT
 - 
                    SpeciesS. cerevisiae (budding yeast)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pRPR1_c2gRNA_RPR1t was a gift from Timothy Lu (Addgene plasmid # 64380 ; http://n2t.net/addgene:64380 ; RRID:Addgene_64380) - 
                
For your References section:
Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949