12x_a1gRNAOp_pCYC1m_yeBFP2
(Plasmid
#64393)
-
Purposeencodes twelve a1 operator sites upstream of minimal pCYC1 promoter driving yeast enhanced BFP
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64393 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS406
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 5500
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameyeast enhanced BFP2
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1000
- Promoter pCYC1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTTTTCTCTAAATATTCTTTCCTTATACATTAGG
- 3′ sequencing primer GGGACCTAGACTTCAGGTTGTCTAACTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
12x_a1gRNAOp_pCYC1m_yeBFP2 was a gift from Timothy Lu (Addgene plasmid # 64393 ; http://n2t.net/addgene:64393 ; RRID:Addgene_64393) -
For your References section:
Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. Farzadfard F, Perli SD, Lu TK. ACS Synth Biol. 2013 Sep 11. 10.1021/sb400081r PubMed 23977949