Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #64657)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 64657 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Structural Genomics Consortium (Addgene Plasmid #26096)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Mutation
    See comments
  • Entrez Gene
    SPOUT1 (a.k.a. C9orf114, CENP-32, HSPC109)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7
  • 3′ sequencing primer sacBpro-R (agtgaacggcaggtatatgtg)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    4RG1 was a gift from Cheryl Arrowsmith (Addgene plasmid # 64657 ; ; RRID:Addgene_64657)