Skip to main content

pCDH-EF1-FHC
(Plasmid #64874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64874 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Cloning Grade DNA 64874-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $110

Backbone

  • Vector backbone
    pCDH-CMV-MCS-EF1-Puro
  • Backbone manufacturer
    System Biosciences
  • Modifications to backbone
    Addition of FLAG and HA tags
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin
  • Tags / Fusion Proteins
    • Flag (C terminal on backbone)
    • HA (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer EF1a-F_alt (gccgtgaacgttctttttc)
  • 3′ sequencing primer IRES-R (CCTCACATTGCCAAAAGACG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Information for Cloning Grade DNA (Catalog # 64874-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $110 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EF1-FHC was a gift from Richard Wood (Addgene plasmid # 64874 ; http://n2t.net/addgene:64874 ; RRID:Addgene_64874)
  • For your References section:

    Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD. PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PGENETICS-D-14-01461 [pii] PubMed 25275444