pASKt15C+SrtA7woH
(Plasmid
#65020)
-
PurposeExpresses the P94R/E105K/E108A/D160N/D165K/K190E/K196T mutant of Staphylococcus aureus sortase A in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65020 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepASK-IBA3 plus
-
Backbone manufacturerIBA
- Backbone size w/o insert (bp) 3211
- Total vector size (bp) 3718
-
Modifications to backboneThe ampicillin-resistance gene is replaced with a chloramphenicol-resistance gene. The pBR322 replicon is replaced with a p15A replicon.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesortase A
-
Alt nameSrtA
-
SpeciesStaphylococcus aureus ATCC 10832
-
Insert Size (bp)512
-
Mutationdeleted amino acids 1-59, P94R, E105K, E108A, D160N, D165A, K190E, K196T
- Promoter tetracycline promoter/operator
-
Tag
/ Fusion Protein
- S tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (destroyed during cloning)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer GAGTTATTTTACCACTCCCT
- 3′ sequencing primer CGCAGTAGCGGTAAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byS. aureus sortase A is originally cloned from a genomic DNA of S. aureus (ATCC 10832D) in our lab.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pASKt15C+SrtA7woH was a gift from Teruyuki Nagamune (Addgene plasmid # 65020 ; http://n2t.net/addgene:65020 ; RRID:Addgene_65020) -
For your References section:
Ca -independent sortase-A exhibits high selective protein ligation activity in the cytoplasm of E. coli. Hirakawa H, Ishikawa S, Nagamune T. Biotechnol J. 2015 Apr 10. doi: 10.1002/biot.201500012. 10.1002/biot.201500012 PubMed 25864513