-
PurposeLentiviral vector expressing the calcium indicator GCaMP6 driven by the muscle-specific promoter MHCK7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 6904
- Total vector size (bp) 8257
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP6
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter MHCK7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- T7 tag (N terminal on insert)
- Xpress epitope (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gcctcgaccggtcgatctcg
- 3′ sequencing primer ttttgtaatccagaggttga (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-MHCK7-GCaMP6 was a gift from Nenad Bursac (Addgene plasmid # 65042 ; http://n2t.net/addgene:65042 ; RRID:Addgene_65042) -
For your References section:
Bioengineered human myobundles mimic clinical responses of skeletal muscle to drugs. Madden L, Juhas M, Kraus WE, Truskey GA, Bursac N. eLife. 2015 Jan 9;4:e04885. doi: 10.7554/eLife.04885. 10.7554/eLife.04885 PubMed 25575180