Skip to main content

pSR646
(Plasmid #65215)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65215 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac-Dual
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 9335
  • Vector type
    Insect Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    modified AAV-2 rep78
  • Insert Size (bp)
    1866
  • Promoter polyhedrin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    modified AAV-6 cap
  • Insert Size (bp)
    2211
  • Promoter P10

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ACGGACCTTTAATTCAACCCA
  • 3′ sequencing primer CTTCCGTGTTTCAGTTAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Rep78 ORF utilizes a non-canonical initiation codon (CTG codon) beginning at nt 6822.

VP1 capsid ORF utilizes a non-canonical initiation codon (TTG codon) beginning at nt 6514.

Additional article references: Barbash et al. Gene Therapy 20: 274-282 (2013).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSR646 was a gift from Robert Kotin (Addgene plasmid # 65215 ; http://n2t.net/addgene:65215 ; RRID:Addgene_65215)
  • For your References section:

    A simplified baculovirus-AAV expression vector system coupled with one-step affinity purification yields high-titer rAAV stocks from insect cells. Smith RH, Levy JR, Kotin RM. Mol Ther. 2009 Nov;17(11):1888-96. doi: 10.1038/mt.2009.128. Epub 2009 Jun 16. 10.1038/mt.2009.128 PubMed 19532142