pRK5RS-HERCD533
(Plasmid
#65224)
-
PurposeExpression of dominant negative EGFR in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRK5
-
Backbone manufacturerBD PharMingen
- Backbone size w/o insert (bp) 4754
- Total vector size (bp) 8654
-
Modifications to backbonemodified MCS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHERCD533
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3900
-
Mutationdeleted AA 654-1186
-
GenBank IDNM_005228
-
Entrez GeneEGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CATACGATTTAGGTGACACTATAG
- 3′ sequencing primer TATAAGCTGCAATAAAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert codes for AA 1-653 (extracellular and transmembrane domains) Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5RS-HERCD533 was a gift from Axel Ullrich (Addgene plasmid # 65224 ; http://n2t.net/addgene:65224 ; RRID:Addgene_65224) -
For your References section:
Anti-oncogenic activity of signalling-defective epidermal growth factor receptor mutants. Redemann N, Holzmann B, von Ruden T, Wagner EF, Schlessinger J, Ullrich A. Mol Cell Biol. 1992 Feb;12(2):491-8. PubMed 1346334