Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Adeno EA
(Plasmid #64071)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64071 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pacAd5
  • Backbone manufacturer
    Gene Transfer Vector Core University of Iowa
  • Backbone size w/o insert (bp) 5679
  • Total vector size (bp) 11538
  • Vector type
    Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    U6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
  • gRNA/shRNA sequence
    Alk (intron 19) Eml4 (intron 14)
  • Species
    M. musculus (mouse)
  • Promoter U6 and CBh
  • Tag / Fusion Protein
    • FLAG-Cas9

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GATGTTGTAGTAAATTTGGG
  • 3′ sequencing primer ATCATGTCTGGATCTCCCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    U6 and Cas9 from pX330 (Zhang Lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Adeno EA was a gift from Andrea Ventura (Addgene plasmid # 64071 ; http://n2t.net/addgene:64071 ; RRID:Addgene_64071)
  • For your References section:

    In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Maddalo D, Manchado E, Concepcion CP, Bonetti C, Vidigal JA, Han YC, Ogrodowski P, Crippa A, Rekhtman N, de Stanchina E, Lowe SW, Ventura A. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. 10.1038/nature13902 PubMed 25337876