shERK2b-mlpx-neo
(Plasmid
#65231)
-
Purposeencodes a shRNA against ERK2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65231 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMLPX
- Backbone size w/o insert (bp) 6728
- Total vector size (bp) 6820
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA against ERK2
-
gRNA/shRNA sequenceGCGCTTCAGACATGAGAAC
-
SpeciesH. sapiens (human)
-
Entrez GeneMAPK1 (a.k.a. ERK, ERK-2, ERK2, ERT1, MAPK2, NS13, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK)
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cccttgaacctcctcGttcgac
- 3′ sequencing primer CTTCGCGCCACCTTCTACTCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shERK2b-mlpx-neo was a gift from Gerardo Ferbeyre (Addgene plasmid # 65231 ; http://n2t.net/addgene:65231 ; RRID:Addgene_65231) -
For your References section:
Tumor suppressor activity of the ERK/MAPK pathway by promoting selective protein degradation. Deschenes-Simard X, Gaumont-Leclerc MF, Bourdeau V, Lessard F, Moiseeva O, Forest V, Igelmann S, Mallette FA, Saba-El-Leil MK, Meloche S, Saad F, Mes-Masson AM, Ferbeyre G. Genes Dev. 2013 Apr 15;27(8):900-15. doi: 10.1101/gad.203984.112. Epub 2013 Apr 18. 10.1101/gad.203984.112 PubMed 23599344