Skip to main content
Addgene

pcDNA3-HA-ERK5 713
(Plasmid #65246)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65246 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 7546
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERK5 713
  • Alt name
    MAPK7 713
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2100
  • Mutation
    deleted AA 714-817
  • GenBank ID
    NM_139033
  • Entrez Gene
    MAPK7 (a.k.a. BMK1, ERK4, ERK5, PRKM7)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert codes for ERK5 AA 2-713 Note: Amino acid number may be off when compared to current NCBI entry. Please check QC sequence to verify end of coding region.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-HA-ERK5 713 was a gift from Axel Ullrich (Addgene plasmid # 65246 ; http://n2t.net/addgene:65246 ; RRID:Addgene_65246)
  • For your References section:

    Phosphotyrosine-specific phosphatase PTP-SL regulates the ERK5 signaling pathway. Buschbeck M, Eickhoff J, Sommer MN, Ullrich A. J Biol Chem. 2002 Aug 16;277(33):29503-9. Epub 2002 May 31. 10.1074/jbc.M202149200 PubMed 12042304