Skip to main content

pcDNA3-PTK7-VSV
(Plasmid #65250)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65250 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 8689
  • Modifications to backbone
    in-frame VSV tag between ApaI and XhoI sites of pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTK7
  • Alt name
    CCK4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3243
  • Entrez Gene
    PTK7 (a.k.a. CCK-4, CCK4)
  • Promoter CMV
  • Tag / Fusion Protein
    • VSV (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-PTK7-VSV was a gift from Axel Ullrich (Addgene plasmid # 65250 ; http://n2t.net/addgene:65250 ; RRID:Addgene_65250)
  • For your References section:

    PTK 7 is a transforming gene and prognostic marker for breast cancer and nodal metastasis involvement. Gartner S, Gunesch A, Knyazeva T, Wolf P, Hogel B, Eiermann W, Ullrich A, Knyazev P, Ataseven B. PLoS One. 2014 Jan 7;9(1):e84472. doi: 10.1371/journal.pone.0084472. eCollection 2014. PONE-D-13-22093 [pii] PubMed 24409301