-
PurposeExpression of ephrinB1 and RFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUW
-
Backbone manufacturerAddgene Plasmid 14882
- Total vector size (bp) 10334
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameephrin B1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1037
-
Entrez GeneEfnb1 (a.k.a. Cek5-L, EFL-3, Elk-L, Epl2, Eplg2, LERK-2, Lerk2, Stra1)
- Promoter UBQ
-
Tag
/ Fusion Protein
- SV40-RFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer hUBCpro-F
- 3′ sequencing primer mRFP1-R GGAGCCGTACTGGAACTGAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PacI-AscI fragment will excise the entire ubiquitin promoter-ephrinB1-SV40-RFP cassette. Bam-AgeI site used to clone ephrin B1 were destroyed.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-ubiquitin-ephrinB1-SV40-RFP (b1R) was a gift from Eduard Batlle (Addgene plasmid # 65446 ; http://n2t.net/addgene:65446 ; RRID:Addgene_65446) -
For your References section:
EphB-ephrin-B interactions suppress colorectal cancer progression by compartmentalizing tumor cells. Cortina C, Palomo-Ponce S, Iglesias M, Fernandez-Masip JL, Vivancos A, Whissell G, Huma M, Peiro N, Gallego L, Jonkheer S, Davy A, Lloreta J, Sancho E, Batlle E. Nat Genet. 2007 Nov;39(11):1376-83. Epub 2007 Sep 30. 10.1038/ng.2007.11 PubMed 17906625