-
PurposeGFP tagged CD47 with its own long 3'UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5372
- Total vector size (bp) 11262
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSignal peptide of CD47
-
SpeciesH. sapiens (human)
-
Insert Size (bp)60
-
GenBank IDNM_001777.3
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer T7 (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP
-
GenBank ID
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer T7 (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCD47 coding region continued and long 3’UTR (with proximal polyadenylation signal changed from AAUAAA to ACUCAA).
-
Insert Size (bp)5116
-
GenBank IDNM_001777.3
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTGAACTTCAAGATCCGCC
- 3′ sequencing primer BGH Rev (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP_CD47_LU was a gift from Christine Mayr (Addgene plasmid # 65474 ; http://n2t.net/addgene:65474 ; RRID:Addgene_65474) -
For your References section:
Alternative 3' UTRs act as scaffolds to regulate membrane protein localization. Berkovits BD, Mayr C. Nature. 2015 Apr 20. doi: 10.1038/nature14321. 10.1038/nature14321 PubMed 25896326