-
PurposeExpresses kinase dead AXL in mammalian cells with cistronic EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRES2-EGFP
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 7927
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTyrosine-protein kinase receptor UFO
-
Alt nameAXL
-
Alt nameUFO
-
Alt nameAXL oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2682
-
MutationK567R
-
GenBank IDAAH32229.1
-
Entrez GeneAXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTGGTCGAGCTGGACGGCGACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IRES-GFP-AXL-KD was a gift from Aaron Meyer (Addgene plasmid # 65498 ; http://n2t.net/addgene:65498 ; RRID:Addgene_65498) -
For your References section:
The AXL Receptor is a Sensor of Ligand Spatial Heterogeneity. Meyer AS, Zweemer AJ, Lauffenburger DA. Cell Syst. 2015 Jul 29;1(1):25-36. 10.1016/j.cels.2015.06.002 PubMed 26236777