attB-mCh-Dnmt3b1-Poly(A)-PuroR
(Plasmid
#65556)
-
PurposePlasmid for Bxb1-mediated recombination of the mCh-Dnmt3b1 cDNA into a MIN-tagged locus using Puromycin selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneattB-mCh-Poly(A)-PuroR
-
Vector typeMammalian Expression, Mouse Targeting ; Bxb1
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDnmt3b
-
SpeciesM. musculus (mouse)
-
Mutationisoform 1
-
Entrez GeneDnmt3b (a.k.a. MmuIIIB)
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGATCACATGGTCCTGCTGG
- 3′ sequencing primer gtggtttgtccaaactcatc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
attB-mCh-Dnmt3b1-Poly(A)-PuroR was a gift from Sebastian Bultmann (Addgene plasmid # 65556 ; http://n2t.net/addgene:65556 ; RRID:Addgene_65556) -
For your References section:
A modular open platform for systematic functional studies under physiological conditions. Mulholland CB, Smets M, Schmidtmann E, Leidescher S, Markaki Y, Hofweber M, Qin W, Manzo M, Kremmer E, Thanisch K, Bauer C, Rombaut P, Herzog F, Leonhardt H, Bultmann S. Nucleic Acids Res. 2015 May 24. pii: gkv550. 10.1093/nar/gkv550 PubMed 26007658