Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT2-7xTcf-NLS-YNL
(Plasmid #65711)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65711 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript II SK(+) based Tol2 donor vector
  • Backbone manufacturer
    Agilent Biotechnology, National Institute of Genetics (Dr Koichi Kawakami Lab)
  • Backbone size w/o insert (bp) 7700
  • Total vector size (bp) 9700
  • Vector type
    Luciferase ; Tol2 system
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    7xTcf, minCMV, 3xNLS, YNL
  • Alt name
    7xTcf-NLS-YNL
  • Species
    Synthetic
  • Insert Size (bp)
    2000

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGATGGGGCTCTAGGAATAAAATATC
  • 3′ sequencing primer GCTCCAGACTGCCTTGGGAAAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Nano-lantern/pcDNA3 (gifted from Dr Takeharu Nagai), Tol2 system (gifted from Dr Koichi Kawakami)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2-7xTcf-NLS-YNL was a gift from Yasushi Okada (Addgene plasmid # 65711 ; http://n2t.net/addgene:65711 ; RRID:Addgene_65711)
  • For your References section:

    Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507