Skip to main content
Addgene

pGF-mSox2-ONL
(Plasmid #65719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65719 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGreenFire1
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 7100
  • Vector type
    Lentiviral, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    murine Sox2 promoter and ONL
  • Alt name
    mSox2-ONL
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    1900

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer CGATTAGTGAACGGATCTCGACG
  • 3′ sequencing primer CGTTGGGAGTGAATTAGCCCTTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hmKusabiraOrange2 (gifted from Dr Atsushi Miyawaki), mSox2 promoter sequence (System Biosciences)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGF-mSox2-ONL was a gift from Yasushi Okada (Addgene plasmid # 65719 ; http://n2t.net/addgene:65719 ; RRID:Addgene_65719)
  • For your References section:

    Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507