-
PurposeExpresses Cre recombinase with a 25 nucleotide extracellular vesicle targeting sequence under the UBC promotor and CFP under the CMV promotor.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65727 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 8225
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCMV promoter driving CFP expression
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Mlul (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCT GCT TCG CGA TGT ACG G (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameUBC promoter driving Cre-25nt expression
- Promoter UBC
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRl (not destroyed)
- 3′ cloning site Xbal (not destroyed)
- 5′ sequencing primer GCCACTCCCACTGTCCTTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CMV-CFP;UBC-Cre25nt was a gift from Jacco van Rheenen (Addgene plasmid # 65727 ; http://n2t.net/addgene:65727 ; RRID:Addgene_65727) -
For your References section:
In Vivo imaging reveals extracellular vesicle-mediated phenocopying of metastatic behavior. Zomer A, Maynard C, Verweij FJ, Kamermans A, Schafer R, Beerling E, Schiffelers RM, de Wit E, Berenguer J, Ellenbroek SI, Wurdinger T, Pegtel DM, van Rheenen J. Cell. 2015 May 21;161(5):1046-57. doi: 10.1016/j.cell.2015.04.042. 10.1016/j.cell.2015.04.042 PubMed 26000481