pSMART-Mev1
(Plasmid
#65815)
-
PurposeNADPH Dependent Mevalonic Acid Production Construct, Low Phosphate Dependent E. coli Expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSMART-HCKan (AF532107.1)
-
Backbone manufacturerLucigen (Middleton, WI)
- Backbone size w/o insert (bp) 1800
- Total vector size (bp) 6275
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemvaE: bifunctional acetoacetyl-CoA thiolase, and NADPH dependent HMG-CoA reductase
-
Alt namemvaE
-
SpeciesSynthetic; Enterococcus faecalis
-
Insert Size (bp)2400
- Promoter insulated waaHp from E. coli
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAG TCC AGT TAC GCT GGA GTC
- 3′ sequencing primer AGAATGTTGCTGAAAAATACCACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemvaS: hydroxymethylglutaryl-CoA synthase
-
Alt namemvaS
-
SpeciesSynthetic; Enterococcus faecalis
-
Insert Size (bp)1100
- Promoter insulated mipAp from E. coli
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CACACAACAAAGGCATTATGAATG
- 3′ sequencing primer GGT CAG GTA TGA TTT AA A TGG TCA GT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMART-Mev1 was a gift from Michael Lynch (Addgene plasmid # 65815 ; http://n2t.net/addgene:65815 ; RRID:Addgene_65815)