Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65815)


Item Catalog # Description Quantity Price (USD)
Plasmid 65815 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pSMART-HCKan (AF532107.1)
  • Backbone manufacturer
    Lucigen (Middleton, WI)
  • Backbone size w/o insert (bp) 1800
  • Total vector size (bp) 6275
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mvaE: bifunctional acetoacetyl-CoA thiolase, and NADPH dependent HMG-CoA reductase
  • Alt name
  • Species
    Synthetic; Enterococcus faecalis
  • Insert Size (bp)
  • Promoter insulated waaHp from E. coli

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAG TCC AGT TAC GCT GGA GTC
  • 3′ sequencing primer AGAATGTTGCTGAAAAATACCACG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mvaS: hydroxymethylglutaryl-CoA synthase
  • Alt name
  • Species
    Synthetic; Enterococcus faecalis
  • Insert Size (bp)
  • Promoter insulated mipAp from E. coli

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACACAACAAAGGCATTATGAATG
  • 3′ sequencing primer GGT CAG GTA TGA TTT AA A TGG TCA GT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSMART-Mev1 was a gift from Michael Lynch (Addgene plasmid # 65815 ; ; RRID:Addgene_65815)