-
PurposeFor trans-synaptic labeling
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65827 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSM
-
Backbone manufacturerC.Bargmann
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 9503
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLG-1
-
Alt nameNLG-1 cDNA
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)2469
-
Entrez Genenlg-1 (a.k.a. CELE_C40C9.5)
- Promoter Punc-4
-
Tag
/ Fusion Protein
- spGFP1-10 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer GCCAAAGGACCCAAAGGTATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMiri K. VanHoven made it originally, named as MVC46
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Punc-4::NGL-1::spGFP1-10 was a gift from Cori Bargmann & Kang Shen (Addgene plasmid # 65827 ; http://n2t.net/addgene:65827 ; RRID:Addgene_65827) -
For your References section:
GFP Reconstitution Across Synaptic Partners (GRASP) defines cell contacts and synapses in living nervous systems. Feinberg EH, Vanhoven MK, Bendesky A, Wang G, Fetter RD, Shen K, Bargmann CI. Neuron. 2008 Feb 7. 57(3):353-63. 10.1016/j.neuron.2007.11.030 PubMed 18255029