Skip to main content

XW54
(Plasmid #65839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65839 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSM
  • Backbone manufacturer
    C.I. Bargmann and S. MaCarroll
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 7712
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-QF-BD-DM-Zipper
  • Species
    Neurospora crassa
  • Insert Size (bp)
    2110
  • GenBank ID
  • Promoter Punc-4c
  • Tag / Fusion Protein
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ggaattgtgagcggataacaatt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XW54 was a gift from Kang Shen (Addgene plasmid # 65839 ; http://n2t.net/addgene:65839 ; RRID:Addgene_65839)
  • For your References section:

    Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Wei X, Potter CJ, Luo L, Shen K. Nat Methods. 2012 Mar 11;9(4):391-5. doi: 10.1038/nmeth.1929. 10.1038/nmeth.1929 PubMed 22406855