Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pC165
(Plasmid #65949)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65949 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PMB1+ROP
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    LacIq is necessary
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RhlI
  • Insert Size (bp)
    645
  • Entrez Gene
    rhlI (a.k.a. PA3476)
  • Promoter pLLac*
  • Tag / Fusion Protein
    • LAA tagged (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gagaaaactagtatgatcgaattgctctctgaatcgctg
  • 3′ sequencing primer taggggaagcttttattacgctgcaagggcgtaattttcgtcgttcgctgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC165 was a gift from Matthew Bennett (Addgene plasmid # 65949 ; http://n2t.net/addgene:65949 ; RRID:Addgene_65949)
  • For your References section:

    SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Chen Y, Kim JK, Hirning AJ, Josic K, Bennett MR. Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794. 10.1126/science.aaa3794 PubMed 26315440