pC236
(Plasmid
#65951)
-
PurposeMedium Repressor plasmid for two-strain system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePMB1+ROP
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsLacIq is necessary
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCinI
-
Insert Size (bp)699
-
GenBank IDAF210630.1
- Promoter Prhl/lac-m
-
Tag
/ Fusion Protein
- LAA tagged (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agaaatactagtatgttcgttatcattcaggcacatgagtatc
- 3′ sequencing primer taggggaagcttttattacgctgcaagggcgtaattttcgtcgttcgctgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC236 was a gift from Matthew Bennett (Addgene plasmid # 65951 ; http://n2t.net/addgene:65951 ; RRID:Addgene_65951) -
For your References section:
SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Chen Y, Kim JK, Hirning AJ, Josic K, Bennett MR. Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794. 10.1126/science.aaa3794 PubMed 26315440