Skip to main content

pC239
(Plasmid #65953)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65953 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    AiiA
  • Species
    Bacillus thuringiensis
  • Insert Size (bp)
    786
  • Promoter pCin*
  • Tag / Fusion Protein
    • LAA tagged (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gagaaaactagtatgacagtaaagaaactttatttcatcccagcag
  • 3′ sequencing primer ggaccagagctcttattacgctgcaagggcgtaattttcgtcgttcgctgc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    LacI
  • Insert Size (bp)
    1122
  • Promoter pCin
  • Tag / Fusion Protein
    • LAA tagged (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer gagaaaactagtatgaaaccagtaacgttatacgatgtcgcag
  • 3′ sequencing primer taggggaagcttttattacgctgcaagggcgtaattttcgtcgttcgctgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC239 was a gift from Matthew Bennett (Addgene plasmid # 65953 ; http://n2t.net/addgene:65953 ; RRID:Addgene_65953)
  • For your References section:

    SYNTHETIC BIOLOGY. Emergent genetic oscillations in a synthetic microbial consortium. Chen Y, Kim JK, Hirning AJ, Josic K, Bennett MR. Science. 2015 Aug 28;349(6251):986-9. doi: 10.1126/science.aaa3794. 10.1126/science.aaa3794 PubMed 26315440
Commonly requested with: